A slow-cycling LGR5 tumour population mediates basal cell carcinoma relapse after therapy.

Material and Methods

Ethical compliance
This study complied with all relevant ethical regulations regarding experiments involving mouse and human skin samples. Mouse colonies were maintained in a certified animal facility in accordance with European guidelines. Experiments involving mice presented in this work were approved by Comité d’Ethique du Bien Être Animal (Université Libre de Bruxelles) under protocol number 483N and 632N, that state that animals should be euthanized if they present tumours that exceed 1 cm in diameter. The BCCs observed in this study were microscopic and ranged from 1.5 mm to 100 μm in diameter and in none of the experiments performed the BCCs exceeded the limit (1 cm in diameter) described in protocols 483N and 632N.
Experiments involving human samples presented in this study were approved by the ethics committee of Vall d’Hebron Institute of Oncology (VHIO) and by the ethics committee of Erasmus Hospital under protocol number P2012/332. Permission and informed consent was obtained from all the patients in order to use their biopsies in this study.

Mice
K14-CreER transgenic mice27 were kindly provided by E. Fuchs, Rockefeller University, USA. Ptch1fl/fl mice 28 and Rosa/SmoM2-YFP
29 mice were obtained from the JAX repository. Lgr5-DTR-GFP mice, knock in mouse that contain the diphtheria toxin receptor (DTR) fused to an enhanced green fluorescent protein (GFP) under the control of Lgr5 regulatory region, allowing to identify the Lgr5-expressing cells using the GFP reporter and to selectively ablate Lgr5 tumour cells by diphtheria toxin (DT) administration12, were kindly provided by Genentech (San Francisco, USA). Tp53fl/fl
30 mice were obtained from the National Cancer Institute at Frederick.
Female and male animals have been used for all experiments and equal gender ratios have been respected in the majority of the analysis. Analysis of the different mutant mice was not blind and sample size was calculated to reach statistical significance. The experiments were not randomized.

Tumour induction
For Ptch1cKO deletion, K14-CreER/Ptch1fl/fl/Lrg5-DTR-GFP mice and K14-CreER/Ptch1fl/fl/TP53fl/fl/Lrg5-DTR-GFP (2.5months old) received one intraperitoneal injection of 2.5mg of tamoxifen during three consecutive days. For SmoM2 expression, K14-CreER/Rosa-SmoM2/Lgr5-DTR-GFP mice (1.5 months old) received one intraperitoneal injection of 1mg of tamoxifen. In the clonal induction experiments, K14-CreER/Rosa-SmoM2 mice (1.5 months old) received one intraperitoneal injection of 0.1mg of tamoxifen.

Vismodegib and LGK-974 administration
Vismodegib/GDC-0449 was kindly provided by Genentech (San Francisco, US) and LGK-974 was kindly provided by Novartis (Bâle, Switzerland). During vismodegib treatment, mice received 150mg vismodegib/kg mice by oral gavage daily. Vismodegib was administered in two doses (one every 12 hours).
During the 10 day LGK-974 treatment mice received: six days 10mg LGK-974 / kg mice by oral gavage and the last 4 days one topical application of 100 μl of 0.2mg/ml of LGK-974 diluted in propylene glycol: ethanol (7:3 v/v). For oral gavage LGK-974 and vismodegib were dissolved in 0.5% methylcellulose solution containing 0.2% Tween-80.

12-O-Tetradecanoylphorbol-13-acetate and retinoic acid administration
12-O-Tetradecanoylphorbol-13-acetate (TPA) and retinoic acid (RA) were used to promote epidermal proliferation31,32. TPA (200 μl of 0.02 mg/ml solution in dimethyl sulfoxide) or retinoic acid (200 μl of 0.5 mM all-trans-RA (Sigma) in dimethyl sulfoxide) was administered daily to shaved mouse back skin for 2 weeks.

DT administration
For Lgr5 lineage cell ablation, mice received a daily intraperitoneal injection of 50 μg/kg of diphtheria toxin (Sigma).

Immunostaining in sections
The tail for the SmoM2 model and ventral skin or back skin for Ptch1cKO model were embedded in optimal cutting temperature compound (OCT, Sakura) and cut into 5–8 μm frozen sections using a CM3050S Leica cryostat (Leica Microsystems).
Immunostainings were performed on frozen sections. Owing to the fusion of SmoM2 with YFP and DTR with GFP, SmoM2-expressing and Lgr5-expressing cells were detected using anti-GFP antibody. Frozen sections were dried and then fixed with 4% paraformaldehyde/PBS (PFA) for 10min at room temperature and blocked with blocking buffer for 1h (PBS, horse serum 5%, BSA 1%, Triton 0.1%). Skin sections were incubated with primary antibodies diluted in blocking buffer overnight at 4 ° C, washed with PBS for 3 × 5 min, and then incubated with Hoechst solution and secondary antibodies diluted in blocking buffer for 1h at room temperature. Finally, sections were washed with PBS for 3 × 5 min at room temperature and mounted in DAKO mounting medium supplemented with 2,5% Dabco (Sigma). Primary antibodies used were the following: anti-B4-integrin (Rat, 1:200, BD, clone346-11A, ref.553745, lot.5239648), anti-GFP (chiken, 1:3000,Abcam,ref.ab13970, lot.236651-23), anti-Active Caspase-3 (rabbit, 1/600, R&D, ref.AF835, lot.CF23517031), anti-Ki67 (rabbit, 1/1000, Abcam, ref.ab15580, lot.GR3198193-1), anti-Lrig1 (goat, 1/500, R&D, ref.AF3688, lot.ZPH0217111), anti-Lef1 (rabbit, 1/100, Cell Signaling, ref.2230), anti-Lhx2 (goat, 1/500, Santa Cruz, sc-19344, lot.K1615), anti-Cux1 (rabbit,1/6000, Santa Cruz, sc-13024), anti-Tbx1 (rabbit, 1/100, Invitrogen) anti-Alcam (goat, 1/1000, Novus, ref.FAB1172F, lot.AASW0111121), anti-Keratin10(rabbit, 1/3000,Covance,ref.PRB-159P-0100), anti-Keratin1 (rabbit, 1/3000, Covance, ref.PRB-165P-0100),anti-Keratin-14 (rabbit, 1/3000, Thermofisher), anti-scd1(goat, 1/500, Santa Cruz, ref.sc14719,lot.H2610), anti-adipophilin (guinea pig,1/5000, Fitzgerald, ref.20R-AP002, lot.P17030911), anti-BrdU(mouse, 1/200, BD, clone 3D4,ref. 560209, lot.4293550)anti-MKL1 (rabbit,1/200, Sigma, ref.HPA030782,lot.C106712) and anti-ARL13b (rabbit, 1:2000,ref.17711-1-AP, Proteintech, lot.49885). The following secondary antibodies were used: anti-rabbit, anti-rat, anti-goat, anti-guinea pig, anti-chicken, conjugated to AlexaFluor488 (Molecular Probes) and to rhodamine Red-X and Cy5 (JacksonImmunoResearch). Images of the Immunostainings in sections were acquired using an Axio Imager M2 microscope and Axiovision 4.8.2 software (Carl Zeiss).

Immunostaining in whole mounts
Whole-mounts of tail epidermis were performed as previously described33 and used to quantify the proportion of surviving clones. Precisely, pieces of tail were incubated for 1h 37°C in EDTA 20mM in PBS in rocking plate, then using forceps the dermis and epidermis were separated and the epidermis was fixed for 30 minutes in paraformaldehyde (PFA) 4% in agitation at room temperature and washed 3 times with PBS.
For the immunostaining: tail skin pieces were blocked with blocking buffer for 3h (PBS, horse serum 5%, Triton 0.8%) in a rocking plate at room temperature. After, the skin pieces were incubated with primary antibodies diluted in blocking buffer overnight at 4 ° C. The next day, they were washed with PBS-Tween 0.2% for 3 × 10 min at room temperature, and then incubated with the secondary antibodies diluted in blocking buffer for 3h at room temperature, washed 2x10 min with PBS-Tween 0.2% and washed for 10min in PBS. Finally, they were incubated in Hoechst diluted in PBS for 30 minutes at room temperature in the rocking plate, washed 3x10 min in PBS and mounted in DAKO mounting medium supplemented with 2,5% Dabco (Sigma). Primary antibodies used were the following: anti-GFP (Rabbit, 1/100, BD, ref. A11122), anti-B4-integrin (Rat, 1:200, BD, ref. 553745) and anti-K31 (Guinea Pig, 1:200, Progen, ref. GP-hHa1). The following secondary antibodies were used: anti-rabbit, anti-rat and anti-guinea pig, conjugated to AlexaFluor488 (Molecular Probes), to rhodamine Red-X (JacksonImmunoResearch) and to Cy5 (1:400, Jackson ImmunoResearch).

BrdU/EdU label retention studies
For the BrdU studies, mice received 3 daily intraperitoneal injections (150 μl of 10mg/ml) (every 8 hours) for 3 consecutive days. For EdU studies, mice received 3 daily intraperitoneal injections (10 μl of 1mg/ml) (every 8 hours) for 3 consecutive days. EdU and BrdU stainings were performed as described 18

In situ hybridization/RNA FISH
The tail in the SmoM2 model and ventral skin in the Ptch1cKO model were embedded in optimal cutting temperature compound (OCT, Sakura) and cut into 5–8μm frozen sections using a CM3050S Leica cryostat (Leica Microsystems). Sections were fixed for 30min in 4%PFA at 4°C and the in situ protocol was performed according to the manufacturer instructions (Advanced Cell diagnostics). The following mouse probes were used: Mm-Lgr5 cat. No. 312171, Mm-Gli1 cat. No. 311001-C2, Mm-Axin2 cat no.400331-C3, Mm-Defensinβ6 cat no.430141-C3.
Human samples were fixed in 4% formalin and embedded in paraffin. Cut sections were deparaffinized and rehydrated before proceeding to the in situ hybridization performed according the manufacturer instructions. The following probes where used: Hs-Lgr5-C2 cat. No. 310991-C2, Hs-Lgr5 cat. No. 311021 and Hs-Axin2 cat no.400241-C3.
The confocal microscope LSM-780 (Carl Zeiss) and ZEN 2.3 software were used to acquire and analyse the ISH images.

Immunohistochemistry
For K14, Ki67, K10 and Lef1 immunohistochemistry in human samples, paraffin sections were deparaffinized, rehydrated, followed by antigen unmasking performed for 20 min at 98 °C in citrate buffer (pH 6) using the PT module. Endogenous peroxidase was blocked using 3% H2O2 (Merck) in methanol for 10 min at room temperature. Endogenous avidin and biotin were blocked using the Endogenous Blocking kit (Invitrogen) for 20 min at room temperature. Nonspecific antigen blocking was performed using blocking buffer. Mouse anti-K14 (rabbit, 1/2000, Thermofisher), anti-Ki67 (rabbit, 1/400, Abcam, ab15580), anti-Keratin10 (rabbit, 1/200, Biolegend, ref.90541) and anti-Lef1 (rabbit, 1/100, Cell Signaling, ref.2230) were incubated overnight at 4 °C. Anti-rabbit biotinylated with blocking buffer, Standard ABC kit, and ImmPACT DAB (Vector Laboratories) was used for the detection of horseradish peroxidase (HRP) activity. Slides were then dehydrated and mounted using SafeMount (Labonord).

FACS Isolation of tumour cells and microarray analysis
Isolation of tumour cells were performed as previously described34. Briefly, Lgr5-DTR-GFP and K14-CreER/Ptch1fl/fl/Lgr5-DTR-GFP mice untreated and upon 8 weeks of vismodegib treatment were sacrificed. Back skin was placed in a petri dish and sterile scalpel was used to remove the adipose tissue and muscle. The skin tissue was incubated with thermolysin (Sigma) for 1h at 37°C and after a scalpel was used to separate epidermis from the dermis. The epidermal tissue was chopped in little pieces and resuspended in PBS supplemented with 5% chelated fetal calf serum and filtered in 70um and 40um cell strainers (BD). Cells were stained using the anti-Lrig1 (goat polyclonal, R&D) followed by the secondary antibody donkey anti-Goat-Alexa 647 (Invitrogen).
Lrg5+Lrig1+ and Lgr5-Lrig1+ cells from untreated K14-CreER/Ptch1fl/fl/Lgr5-DTR-GFP animals and 8 weeks treated with vismodegib mice were sorted using Lrig1 staining and native Lgr5-GFP. 2000-sorted cells per sample were collected directly in 45 μl of lysis buffer (20 mM DTT, 10 mM Tris–HCl pH 7.4, 0.5% SDS, 0.5 μg μl–1 proteinase K). Samples were then lysed at 65 °C for 15 min and frozen. RNA isolation, amplification and microarray were performed at the IRB Functional Genomics Core, Barcelona. cDNA synthesis, library preparation and amplification were performed as described 35. Microarrays using Mouse Genome 430 PM strip Affymetrix array were performed and the data was normalized using RMA algorithm. Biological duplicates were performed for all conditions. Genetic signatures were obtained by considering genes presenting a fold change greater or smaller than 2 or –2, respectively, in each replicates.

FACS isolation of CD71+ and CD71- populations of tumour cells, RNA extraction and quantitative PCR
Isolation of TCs from mouse skin was performed as described in the previous section. Cells were stained using the anti-Lrig1 (goat polyclonal, R&D) and anti-CD71-PE (rat, BD) followed by the secondary antibody donkey anti-Goat-Alexa 647 (Invitrogen). 7000 FACS sorted cells were harvested directly in the lysis buffer provided by the manufacturer (RNAeasy Microkit, Quiagen) and RNA extraction was then carried out according to the manufacturer's protocol. Purified RNA was used to synthesize the first-strand complementary DNA using SuperScript II (Invitrogen) with random hexamers (Roche). Quantitative PCR analyses were carried out with Light Cycler 96 (Roche). Primers used: Ki67-F: CCTGCCTCAGATGGCTCAAA, Ki67-R: GGTTCCCTGTAACTGCTCCC, Aurka-F: AACACAACGCAAGCCAAAGG, Aurka-R: GGCCAGTTGGAGGTTTGGAA, K10-F: AACTGACAATGCCAACGTGC, K10-R: TAGGTAGGCCAGCTCTTCGT, K1-F: ACAACCCGGACCCAAAACTT, K1-R: CTCTGCGTTGGTCCTCTTGT, SCD1-F: ACACCATGGCGTTCCAGAAT and SCD1-R: AGCTTCTCGGCTTTCAGGTC. Normalizers: HPRT-F: GCAGTACAGCCCCAAAATGG, HPRT-R: TCCAACAAAGTCTGGCCTGT, βActin-F: GAAGCTGTGCTATGTTGCTCTA, βActin-R: CAATAGTGATGACCTGGCCGT, β2M-F: TCACCCCCACTGAGACTGAT, β2M-R: TCCCAGTAGACGGTCTTGGG, Gapdh-F: CGTGTTCCTACCCCCAATGT, Gapdh-R: GTGTAGCCCAAGATGCCCTT, Tbox-F: GTACCGCAGCTTCAAAATATTGTAT and Tbox-R: AAATCAACGCAGTTGTGCGTG

Sequencing of the Smo gene in vismodegib-persistent lesions
A total of 200.000 Lgr5+Lrig1+ TCs from 3 Ptch1cKO mice treated for 8 weeks with vismodegib were FACS-sorted following the same protocol described above. Exons 3- 12 of the mouse Smo gene were amplified using PCR and the products of the PCR were purified using the Monarch DNA Gel Extraction Kit (ref. T1020). The products of the PCR were sequenced following the Sanger standard using chemistry BigDy31.1, the cycle sequencing technology based on dideoxy chain termination/cycle sequencing and performed on ABI 3730XL sequencer. SnapGene version 4.1.3 was used for the analysis. Description of the the amplification primers used and sequencing results can be found in Source Data.

Grafting experiments
For transplantation experiments 100.000 cells previously FACS-sorted to obtain pure populations of Lgr5+Lrig1+ and Lgr5-Lrig1+ cells were transplanted in the interscapular fat pad of nod-scid immunodeficient mice. The 100.000 cells Lgr5+Lrig1+ and Lgr5-Lrig1+ cells were mixed in a proportion 1/40 tumour associated fibroblasts from the same tumours (FACS sorted using CD140a marker). The tumour cells and fibroblasts were embedded in 50μl of matrigel containing ROCK-inhibitor (3.3μg/ml) and transplanted in the fat pad.

GSEA analysis
The GSEA program was downloaded from the BROAD institute website (http://www.broadinstitute.org/gsea/). We used the GSEA preranked option with standard parameters of weighted enrichment score calculation to run the GSEA against a user-supplied fold-change-ranked list of genes. Results of the enrichment analysis were plotted using R software

Ptch1 deletion
To determine the deletion of the two Ptch1 alleles in the Lgr5+Lrig1+ and Lgr5-Lrig1+ populations 200.000 cells were FACS-sorted and DNA was extracted using the QiAmp DNA Mini-Kit (Qiagen). The following primers Forward: AAAGAGATCTTGTGGGCAAGG, Reverse:CTACTTCCATTTGTCACGTCC were used to determine the presence of the floxed/floxed or deleted alleles.

Extended Data

Supplementary Material
Reporting Summary